Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV2ss-U6-sgHTT1-7sk-sgCas9
(Plasmid #190900)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190900 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAVss
  • Backbone size w/o insert (bp) 3534
  • Total vector size (bp) 4378
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    HTT and Cas9
  • Species
    H. sapiens (human); spCas9
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)
  • Promoter U6 and 7sk

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGACTATCATATGCTTACCGTAAC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV2ss-U6-sgHTT1-7sk-sgCas9 was a gift from Nicole Déglon (Addgene plasmid # 190900 ; http://n2t.net/addgene:190900 ; RRID:Addgene_190900)
  • For your References section:

    Semi-automated workflows to quantify AAV transduction in various brain areas and predict gene editing outcome for neurological disorders. Duarte F, Ramosaj M, Hasanovic E, Regio S, Sipion M, Rey M, Deglon N. Mol Ther Methods Clin Dev. 2023 Mar 27;29:254-270. doi: 10.1016/j.omtm.2023.03.013. eCollection 2023 Jun 8. 10.1016/j.omtm.2023.03.013 PubMed 37090478