Skip to main content
Addgene

pUC18_BCR_GUSB_ABL1_e14a3
(Plasmid #190885)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190885 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC18
  • Backbone manufacturer
    University of California
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 7738
  • Vector type
    cloned cDNA transcripts for use in RT-qPCR BCR::ABL1 monitoring of atypical transcripts

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    e14a3 BCR::ABL1 fusion transcript
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1433

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ttcagaagcttctccctgacat
  • 3′ sequencing primer CTTCGTCTGAGATACTGGATTCCT
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ABL1 cDNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1803
  • GenBank ID
    X16416
  • Entrez Gene
    ABL1 (a.k.a. ABL, BCR-ABL, CHDSKM, JTK7, bcr/abl, c-ABL, c-ABL1, p150, v-abl)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgttggaactccaaggaaaa
  • 3′ sequencing primer gaaggcgctcatcttcattc
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    GUSB cDNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    813
  • GenBank ID
    NM_000181
  • Entrez Gene
    GUSB (a.k.a. BG, MPS7)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer tttccgtaccagccactacc
  • 3′ sequencing primer gtaaacgggctgttttccaa
    • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    BCR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    963
  • GenBank ID
    Y00661
  • Entrez Gene
    BCR (a.k.a. ALL, BCR1, CML, D22S11, D22S662, PHL)

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTCCACTCAGCCACTGGATT
  • 3′ sequencing primer CAAGGACCAGCTGTCAGTCA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid can be linearised using SalI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC18_BCR_GUSB_ABL1_e14a3 was a gift from Nicholas Cross (Addgene plasmid # 190885 ; http://n2t.net/addgene:190885 ; RRID:Addgene_190885)

  • For your References section:

    Assessment of individual molecular response in chronic myeloid leukemia patients with atypical BCR-ABL1 fusion transcripts: recommendations by the EUTOS cooperative network. Schafer V, White HE, Gerrard G, Mobius S, Saussele S, Franke GN, Mahon FX, Talmaci R, Colomer D, Soverini S, Machova Polakova K, Cross NCP, Hochhaus A, Ernst T. J Cancer Res Clin Oncol. 2021 Oct;147(10):3081-3089. doi: 10.1007/s00432-021-03569-8. Epub 2021 Mar 7. 10.1007/s00432-021-03569-8 PubMed 33677711
Related items: