Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTSK573
(Plasmid #190881)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190881 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTSK568
  • Backbone size w/o insert (bp) 6958
  • Total vector size (bp) 7897
  • Vector type
    Bacterial cloning vector
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag
  • Species
    Bacteria Rhodococcus rhodochrous
  • Insert Size (bp)
    939

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer cgatccgcttgagcaaagcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSK573 was a gift from Tatiana Karpova & Gunjan Mehta (Addgene plasmid # 190881 ; http://n2t.net/addgene:190881 ; RRID:Addgene_190881)
  • For your References section:

    Single-molecule tracking for studying protein dynamics and target-search mechanism in live cells of S. cerevisiae. Podh NK, Das A, Dey P, Paliwal S, Mehta G. STAR Protoc. 2022 Dec 16;3(4):101900. doi: 10.1016/j.xpro.2022.101900. Epub 2022 Dec 5. 10.1016/j.xpro.2022.101900 PubMed 36595957