pMD19-PBBa_J23117-sgRNA-Spr
(Plasmid #190793)

• Purpose: Template vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.
• Depositing Lab: Paul Hudson
• Publication: Cengic et al ACS Synth Biol. 2022 Aug 15. doi: 10.1021/acssynbio.2c00375.

Backbone

• Vector backbone: pMD19
• Backbone manufacturer: Takara
• Backbone size w/o insert (bp): 2125
• Total vector size (bp): 3987
• Modifications to backbone: A silent mutation of a BsaI-site found in the AmpR gene. A B0015 terminator and SpR cassette has been added to the backbone.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Spectinomycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA (dummy)
• gRNA/shRNA sequence: ACTATATTTTTCAAAGATGA
• Species: Synthetic
• Promoter: BBa_J23117

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI, SpeI (destroyed during cloning)
• 5′ sequencing primer: -
• 3′ sequencing primer: -

Resource Information

• Supplemental Documents:
  • pMD19-PJ23117-sgRNA(dummy)-B0015-SpR (_BsaI-sites).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry