pCosSAD1AprR
(Plasmid #190786)

• Purpose: An E. coli cloning vector for the integration of heterologous genes into a linear plasmid pSA3239 in Streptomyces lavendulae subsp. lavendulae CCM 3239 through homologous recombination
• Depositing Lab: Jan Kormanec
• Publication: Novakova et al Appl Microbiol Biotechnol. 2022 Nov;106(21):7285-7299. doi: 10.1007/s00253-022-12187-4. Epub 2022 Sep 29.

Backbone

• Vector backbone: sCos-1
• Backbone size w/o insert (bp): 7907
• Total vector size (bp): 23985
• Vector type: Bacterial Expression
• Selectable markers: apramycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: upstream region of the aur1 cluster for auricin
• Species: pSA3239
• Insert Size (bp): 5719
• GenBank ID: KJ396772

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sau3AI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: ccgaaaagtgccacctgacg
• 3′ sequencing primer: GGAATCCTGCTCTGCGAGGCTGGC

Gene/Insert 2

• Gene/Insert name: ampramycin resistance cassette
• Alt name: aac(3)IV
• Species: pIJ773

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (unknown if destroyed)
• 3′ cloning site: XbaI (destroyed during cloning)
• 5′ sequencing primer: cggcgtgagcgactctccatcc
• 3′ sequencing primer: tcgggatgctcacgaaaagcc

Gene/Insert 3

• Gene/Insert name: downstream region of the aur1 cluster for auricin
• Species: pSA3239
• GenBank ID: KJ396772

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (destroyed during cloning)
• 3′ cloning site: Sau3AI (not destroyed)
• 5′ sequencing primer: CGATGCCGCTCGCCAGTCGATTGG
• 3′ sequencing primer: cagagcttatcgatgataagc

Resource Information

• Supplemental Documents:
  • pCosSAD1AprR.gbk
• A portion of this plasmid was derived from a plasmid made by: Apramycin resistance resistance cassette was PCR amplified from pIJ773

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry