Skip to main content
Addgene

pCosSAD1AprR
(Plasmid #190786)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190786 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    sCos-1
  • Backbone size w/o insert (bp) 7907
  • Total vector size (bp) 23985
  • Vector type
    Bacterial Expression
  • Selectable markers
    apramycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    upstream region of the aur1 cluster for auricin
  • Species
    pSA3239
  • Insert Size (bp)
    5719
  • GenBank ID
    KJ396772

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sau3AI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ccgaaaagtgccacctgacg
  • 3′ sequencing primer GGAATCCTGCTCTGCGAGGCTGGC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ampramycin resistance cassette
  • Alt name
    aac(3)IV
  • Species
    pIJ773

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site XbaI (destroyed during cloning)
  • 5′ sequencing primer cggcgtgagcgactctccatcc
  • 3′ sequencing primer tcgggatgctcacgaaaagcc
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    downstream region of the aur1 cluster for auricin
  • Species
    pSA3239
  • GenBank ID
    KJ396772

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site Sau3AI (not destroyed)
  • 5′ sequencing primer CGATGCCGCTCGCCAGTCGATTGG
  • 3′ sequencing primer cagagcttatcgatgataagc
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Apramycin resistance resistance cassette was PCR amplified from pIJ773

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCosSAD1AprR was a gift from Jan Kormanec (Addgene plasmid # 190786 ; http://n2t.net/addgene:190786 ; RRID:Addgene_190786)

  • For your References section:

    A stable vector for efficient production of heterologous proteins and secondary metabolites in streptomycetes. Novakova R, Homerova D, Csolleiova D, Rezuchova B, Sevcikova B, Javorova R, Feckova L, Kormanec J. Appl Microbiol Biotechnol. 2022 Nov;106(21):7285-7299. doi: 10.1007/s00253-022-12187-4. Epub 2022 Sep 29. 10.1007/s00253-022-12187-4 PubMed 36173451
Related items:
Commonly requested with: