Skip to main content
Addgene

pPhiC31-actIIORF4
(Plasmid #190785)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190785 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 4065
  • Total vector size (bp) 8950
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    T5 terminator
  • Alt name
    SLAV_24935 terminator
  • Species
    Streptomyces lavendulae subsp. lavendulae CCM 3239
  • Insert Size (bp)
    455
  • GenBank ID
    CP024985 ATZ26784.1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGAATCCTGCTCTGCGAGGCTGGC
  • 3′ sequencing primer catgatcgcgtagtcgatagtgg
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    actII-4
  • Alt name
    SCO5085
  • Species
    Streptomyces coelicolor M145
  • Insert Size (bp)
    768
  • GenBank ID
    AL645882 SCBAC28G1.11

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer gtgtcgaagtcgacggtgacg
  • 3′ sequencing primer catgatcgcgtagtcgatagtgg
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    kasOp*
  • Alt name
    synthetic kasOp* promoter
  • Species
    synthetic
  • Insert Size (bp)
    72

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gtgtcgaagtcgacggtgacg
  • 3′ sequencing primer catgatcgcgtagtcgatagtgg
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The actII-4 gene was PCR amplified from Streptomyces coelicolor M145 chromosomal DNA; T5 terminator insert was PCR amplified from Streptomyces lavendulae subsp. lavendulae CCM 3239 chromosomal DNA, kasOp* promoter was cloned as synthetic gene insert

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPhiC31-actIIORF4 was a gift from Jan Kormanec (Addgene plasmid # 190785 ; http://n2t.net/addgene:190785 ; RRID:Addgene_190785)

  • For your References section:

    A stable vector for efficient production of heterologous proteins and secondary metabolites in streptomycetes. Novakova R, Homerova D, Csolleiova D, Rezuchova B, Sevcikova B, Javorova R, Feckova L, Kormanec J. Appl Microbiol Biotechnol. 2022 Nov;106(21):7285-7299. doi: 10.1007/s00253-022-12187-4. Epub 2022 Sep 29. 10.1007/s00253-022-12187-4 PubMed 36173451
Related items: