Skip to main content
Addgene

pcDNA3.1_rSERT_WT
(Plasmid #190743)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190743 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 7423
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC6A4 Serotonin Transporter
  • Alt name
    SERT
  • Alt name
    SLC6A4
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1959
  • GenBank ID
    NC_051345 NM_013034.4
  • Entrez Gene
    Slc6a4 (a.k.a. SERT)
  • Promoter CMV
  • Tags / Fusion Proteins
    • c-myc (N terminal on insert)
    • His6 (C terminal on insert)
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGCCAACATGCCAGCATCC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    B J Hoffman, Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please also see:
Zhang YW, Turk BE, Rudnick G. Control of serotonin transporter phosphorylation by conformational state. Proc Natl Acad Sci U S A. 2016 May 17;113(20):E2776-83. doi: 10.1073/pnas.1603282113. Epub 2016 May 2. PMID: 27140629; PMCID: PMC4878475.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_rSERT_WT was a gift from Gary Rudnick (Addgene plasmid # 190743 ; http://n2t.net/addgene:190743 ; RRID:Addgene_190743)

  • For your References section:

    Structure-based Discovery of Conformationally Selective Inhibitors of the Serotonin Transporter. Singh I, Seth A, Billesbølle CB, Braz J, Rodriguiz RM, Roy K, Bekele B, Craik V, Huang X, Boytsov D, Lak P, O’Donnell H, Sandtner W, Roth BL, Basbaum AI, Wetsel WC, Manglik A, Shoichet BK, Rudnick G. bioRxiv 2022.06.13.495991 10.1101/2022.06.13.495991 PubMed 11592963
Related items: