Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDH-DCX-TurboID-V5-puro
(Plasmid #190742)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDH-CMV-MCS-EF1-Puro
  • Backbone size w/o insert (bp) 7368
  • Total vector size (bp) 9563
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DCX-TurboID-V5
  • Species
    H. sapiens (human); DCX is human doublecortin; TurboID is engineered BirA from E.coli
  • Insert Size (bp)
    1914
  • GenBank ID
  • Entrez Gene
    DCX (a.k.a. DBCN, DC, LISX, SCLH, XLIS)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer pCDH-Rev (tcggcaattgaacgggtgcctaga)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-DCX-TurboID-V5-puro was a gift from Jeremy Baskin (Addgene plasmid # 190742 ; http://n2t.net/addgene:190742 ; RRID:Addgene_190742)
  • For your References section:

    Proximity Labeling Reveals Spatial Regulation of the Anaphase-Promoting Complex/Cyclosome by a Microtubule Adaptor. Cao X, Shami Shah A, Sanford EJ, Smolka MB, Baskin JM. ACS Chem Biol. 2022 Aug 11. doi: 10.1021/acschembio.2c00527. 10.1021/acschembio.2c00527 PubMed 35952650