pCDH-EMTB-TurboID-V5-puro
(Plasmid #190741)

• Purpose: A lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)
• Depositing Lab: Jeremy Baskin
• Publication: Cao et al ACS Chem Biol. 2022 Aug 11. doi: 10.1021/acschembio.2c00527.

Backbone

• Vector backbone: pCDH-CMV-MCS-EF1-Puro
• Backbone size w/o insert (bp): 7368
• Total vector size (bp): 9287
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EMTB-TurboID-V5
• Species: H. sapiens (human); EMTB is human ensconsin; TurboID is engineered BirA from E.coli
• Insert Size (bp): 1914
• Mutation: Microtubule binding-domain of ensconsin (amino acids 18-282 of GenBank reference sequence X73882)
• GenBank ID:
• Entrez Gene: RPS14 (a.k.a. EMTB, S14, uS11)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CMV forward
• 3′ sequencing primer: pCDH-Rev (tcggcaattgaacgggtgcctaga)

Resource Information

• Supplemental Documents:
  • pCDH-EMTB-TurboID-V5-puro.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry