Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSN818
(Plasmid #190690)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190690 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    P1316-IgG2a
  • Backbone manufacturer
    Gavin Wright, Sanger; Yves Durocher, NRC
  • Backbone size w/o insert (bp) 5925
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    anti-kinesin (Mus musculus) recombinant mouse monoclonal antibody; IgG heavy and light chains
  • Species
    M. musculus (mouse), Synthetic
  • Promoter Dual CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtccactcccaggtccaag
  • 3′ sequencing primer agccagaggtcgaggtcggggg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA for anti-kinesin heavy chain antibody was cloned from H2 hybridoma obtained from Dr. George Bloom (University of Virginia). Please cite Pfister et al., JCB, 1989.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

H2 is an anti-kinesin heavy chain monoclonal antibody (Pfister et al., JCB, 1989)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSN818 was a gift from Shinsuke Niwa (Addgene plasmid # 190690 ; http://n2t.net/addgene:190690 ; RRID:Addgene_190690)
  • For your References section:

    Generation of recombinant and chickenized scFv versions of an anti-kinesin monoclonal antibody H2. Niwa S, Chiba K. Cytoskeleton (Hoboken). 2023 Apr 10. doi: 10.1002/cm.21756. 10.1002/cm.21756 PubMed 37036074