Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ5004_hU6_sgRNA targeting e4
(Plasmid #190686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190686 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 8861
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting enhancer 4 of MYC
  • gRNA/shRNA sequence
    GGCTGGCTGGGTCTGGTAGT
  • Species
    H. sapiens (human)
  • GenBank ID
    NG_007161
  • Promoter Human U6 promoter
  • Tags / Fusion Proteins
    • BFP (C terminal on insert)
    • Puromycin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer tcttGTGGAAAGCCAGAAACATGGGCTGGCTGGGTCTGGTAGTgttttagagctaGAAAtagcaagttaaaataaggc
  • 3′ sequencing primer cgcctaatggatcctagtactcga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ5004_hU6_sgRNA targeting e4 was a gift from Stanley Qi (Addgene plasmid # 190686 ; http://n2t.net/addgene:190686 ; RRID:Addgene_190686)
  • For your References section:

    Nested epistasis enhancer networks for robust genome regulation. Lin X, Liu Y, Liu S, Zhu X, Wu L, Zhu Y, Zhao D, Xu X, Chemparathy A, Wang H, Cao Y, Nakamura M, Noordermeer JN, La Russa M, Wong WH, Zhao K, Qi LS. Science. 2022 Aug 11:eabk3512. doi: 10.1126/science.abk3512. 10.1126/science.abk3512 PubMed 35951677