pSLQ1373_mU6_sgRNA targeting e1
(Plasmid
#190684)
-
PurposesgRNA targeting enhancer 1 of MYC
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 8889
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting enhancer 1 of MYC
-
gRNA/shRNA sequenceGAACCTTCAGGGAAAAGGCTT
-
SpeciesH. sapiens (human)
-
GenBank ID
- Promoter mouse U6 promoter
-
Tags
/ Fusion Proteins
- BFP (C terminal on insert)
- Puromycin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer cttggagaaCCAcctTGTTGGAACCTTCAGGGAAAAGGCTTGTTTAAGAGCTAAGCTGGAAACAGCATAG
- 3′ sequencing primer taatggatcctagtactcgaGAAAAAAAGCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ1373_mU6_sgRNA targeting e1 was a gift from Stanley Qi (Addgene plasmid # 190684 ; http://n2t.net/addgene:190684 ; RRID:Addgene_190684) -
For your References section:
Nested epistasis enhancer networks for robust genome regulation. Lin X, Liu Y, Liu S, Zhu X, Wu L, Zhu Y, Zhao D, Xu X, Chemparathy A, Wang H, Cao Y, Nakamura M, Noordermeer JN, La Russa M, Wong WH, Zhao K, Qi LS. Science. 2022 Aug 11:eabk3512. doi: 10.1126/science.abk3512. 10.1126/science.abk3512 PubMed 35951677