Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBITE-EGFRvIII-F271-OKT3
(Plasmid #190682)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190682 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Derived from pSLCAR
  • Backbone manufacturer
    Synthetic
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Anti-EGFRvIII-scFv-F271-modularized-OKT3-HisTag
  • Alt name
    Blinatumomab Biosimilar
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    2493
  • Promoter EFS
  • Tag / Fusion Protein
    • mNeonGreen (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer CGCAACGGGTTTGCCGCCAGAACACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBITE-EGFRvIII-F271-OKT3 was a gift from Scott McComb (Addgene plasmid # 190682 ; http://n2t.net/addgene:190682 ; RRID:Addgene_190682)
  • For your References section:

    A simplified function-first method for the discovery and optimization of bispecific immune engaging antibodies. Shepherd A, Bennychen B, Marcil A, Bloemberg D, Pon RA, Weeratna RD, McComb S. PLoS One. 2023 Jun 22;18(6):e0273884. doi: 10.1371/journal.pone.0273884. eCollection 2023. 10.1371/journal.pone.0273884 PubMed 37347762