pSPIH6
(Plasmid #190676)

• Purpose: E. coli plasmid for single step cloning of SUMO-peptide-intein (SPI) fusion proteins (contains SUMO and His-tagged intein)
• Depositing Lab: John Vederas
• Publication: Lamer et al BMC Biotechnol. 2023 Apr 5;23(1):11. doi: 10.1186/s12896-023-00779-5.

Backbone

• Vector backbone: pTXB1
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6706
• Total vector size (bp): 7038
• Modifications to backbone: Added C-terminal hexa-His tag to the Mxe GyrA intein, and a PacI restriction site at the 5' end of the intein sequence (at the 3' end of the inserted His6-SUMO tag)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Small ubiquitin-like modifier
• Alt name: His6-SUMO
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 357
• Mutation: None
• GenBank ID: MT011393.1
• Promoter: T7
• Tag / Fusion Protein:
  • N-terminal His tag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCATAAACTGCCAGGAATTGGGG
• 3′ sequencing primer: CACGGGATTGCCATGCCGG

Gene/Insert 2

• Gene/Insert name: Mxe GyrA intein with C-terminal chitin binding domain and His tag
• Species: Mycobacterium xenopii
• Insert Size (bp): 798
• Mutation: Added C-terminal his tag
• GenBank ID: MW879740.1
• Promoter: T7
• Tags / Fusion Proteins:
  • Chitin binding domain (C terminal on insert)
  • His tag (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCGCGAAATTAATACGACTCA
• 3′ sequencing primer: ATCCGGATATAGTTCCTCCTTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The His6-SUMO gene is from the Champion™ pET SUMO Expression System (Invitrogen), and the pTXB1 backbone is from New England BioLabs

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please hold for publication.