Skip to main content
Addgene

pSPIH6
(Plasmid #190676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190676 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTXB1
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6706
  • Total vector size (bp) 7038
  • Modifications to backbone
    Added C-terminal hexa-His tag to the Mxe GyrA intein, and a PacI restriction site at the 5' end of the intein sequence (at the 3' end of the inserted His6-SUMO tag)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Small ubiquitin-like modifier
  • Alt name
    His6-SUMO
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    357
  • Mutation
    None
  • GenBank ID
    MT011393.1
  • Promoter T7
  • Tag / Fusion Protein
    • N-terminal His tag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCATAAACTGCCAGGAATTGGGG
  • 3′ sequencing primer CACGGGATTGCCATGCCGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Mxe GyrA intein with C-terminal chitin binding domain and His tag
  • Species
    Mycobacterium xenopii
  • Insert Size (bp)
    798
  • Mutation
    Added C-terminal his tag
  • GenBank ID
    MW879740.1
  • Promoter T7
  • Tags / Fusion Proteins
    • Chitin binding domain (C terminal on insert)
    • His tag (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCGCGAAATTAATACGACTCA
  • 3′ sequencing primer ATCCGGATATAGTTCCTCCTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The His6-SUMO gene is from the Champion™ pET SUMO Expression System (Invitrogen), and the pTXB1 backbone is from New England BioLabs

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please hold for publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSPIH6 was a gift from John Vederas (Addgene plasmid # 190676 ; http://n2t.net/addgene:190676 ; RRID:Addgene_190676)
  • For your References section:

    Simplified cloning and isolation of peptides from "sandwiched" SUMO-peptide-intein fusion proteins. Lamer T, Vederas JC. BMC Biotechnol. 2023 Apr 5;23(1):11. doi: 10.1186/s12896-023-00779-5. 10.1186/s12896-023-00779-5 PubMed 37020212