dora[B]_rescue_construct
(Plasmid
#190637)
-
PurposePuromycin-selectable expression of Dora[T295M] (CG34401) in Drosophila S2 cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAc-sgRNA-Cas9
-
Backbone manufacturerJi-Long Liu
- Backbone size w/o insert (bp) 6296
- Total vector size (bp) 12427
-
Modifications to backbonedouble-digested with BstZ17I and SapI to disrupt sgRNA expression
-
Vector typeInsect Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDorado
-
Alt nameDora
-
Alt nameCG34401
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)6286
-
MutationChanged threonine 295 to methionine
-
Entrez GeneCG34401 (a.k.a. Dmel_CG34401, CG15037, CG17757, CG32542, CG7307, CG7317, Dmel\CG34401, Dmel_CG17757, Dmel_CG32542)
- Promoter Actin-5c
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer gagttcttgtgctgtgtgga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dora[B]_rescue_construct was a gift from David Bartel (Addgene plasmid # 190637 ; http://n2t.net/addgene:190637 ; RRID:Addgene_190637) -
For your References section:
Endogenous transcripts direct microRNA degradation in Drosophila, and this targeted degradation is required for proper embryonic development. Kingston ER, Blodgett LW, Bartel DP. Mol Cell. 2022 Sep 15. pii: S1097-2765(22)00849-8. doi: 10.1016/j.molcel.2022.08.029. 10.1016/j.molcel.2022.08.029 PubMed 36150386