doraWT_rescue_construct
(Plasmid #190609)

• Purpose: Puromycin-selectable expression of Dora (CG34401) in Drosophila S2 cells
• Depositing Lab: David Bartel
• Publication: Kingston et al Mol Cell. 2022 Sep 15. pii: S1097-2765(22)00849-8. doi: 10.1016/j.molcel.2022.08.029.

Backbone

• Vector backbone: pAc-sgRNA-Cas9
• Backbone manufacturer: Ji-Long Liu
• Backbone size w/o insert (bp): 6300
• Total vector size (bp): 12427
• Modifications to backbone: double-digested with BstZ17I and SapI to disrupt sgRNA expression
• Vector type: Insect Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Dorado
• Alt name: Dora
• Alt name: CG34401
• Species: D. melanogaster (fly)
• Insert Size (bp): 6286
• Entrez Gene: CG34401 (a.k.a. Dmel_CG34401, CG15037, CG17757, CG32542, CG7307, CG7317, Dmel\CG34401, Dmel_CG17757, Dmel_CG32542)
• Promoter: Actin-5c

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: FseI (not destroyed)
• 5′ sequencing primer: gagttcttgtgctgtgtgga

Resource Information

• Supplemental Documents:
  • doraWT_rescue_construct.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry