pWPT-mEGFP
(Plasmid
#190606)
-
PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePlasmid 49235: pWPT-/GCCACC-mEGFP-IRES-mCherry
- Backbone size w/o insert (bp) 10727
- Total vector size (bp) 10729
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemEGFP
-
SpeciesSynthetic
-
Insert Size (bp)738
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)710
-
Mutationa deletion was created in mCherry CDS impairing its expression
- Promoter EIF1-short
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (destroyed during cloning)
- 3′ cloning site PstI (destroyed during cloning)
- 5′ sequencing primer ATAAGTGCAGTAGTCGCCGT
- 3′ sequencing primer CATTAAAGCAGCGTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWPT-mEGFP was a gift from Alessandro Quattrone (Addgene plasmid # 190606 ; http://n2t.net/addgene:190606 ; RRID:Addgene_190606) -
For your References section:
Translational enhancement by base editing of the Kozak sequence rescues haploinsufficiency. Ambrosini C, Destefanis E, Kheir E, Broso F, Alessandrini F, Longhi S, Battisti N, Pesce I, Dassi E, Petris G, Cereseto A, Quattrone A. Nucleic Acids Res. 2022 Oct 14;50(18):10756-10771. doi: 10.1093/nar/gkac799. 10.1093/nar/gkac799 PubMed 36165847