pWPT-mCherry
(Plasmid #190605)

• Purpose: Obtained by cloning 5 stop codons in place of the EGFP Kozak sequence in pWPT-/mEGFP-1T-IRES-mCherry
• Depositing Lab: Alessandro Quattrone
• Publication: Ambrosini et al Nucleic Acids Res. 2022 Oct 14;50(18):10756-10771. doi: 10.1093/nar/gkac799.

Backbone

• Vector backbone: Plasmid 49235: pWPT-/GCCACC-mEGFP-IRES-mCherry
• Backbone size w/o insert (bp): 10727
• Total vector size (bp): 10721
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mEGFP
• Species: Synthetic
• Insert Size (bp): 738
• Mutation: EGFP Kozak sequence has been replaced with a stretch of stop codons, impeding EGFP expression.
• Promoter: EIF1-short

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATAAGTGCAGTAGTCGCCGT

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711

Resource Information

• Supplemental Documents:
  • pWPT-mCherry.txt.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry