pX458-HypaCas9
(Plasmid
#190604)
-
Purpose(Empty Backbone) PX458 (Plasmid #48138) with the N692A, M694A, Q695A, and H698A mutations
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138)
- Backbone size (bp) 9288
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang. Addgene plasmid # 48138 was modified with N692A, M694A, Q695A, and H698A mutations.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.04.482947v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-HypaCas9 was a gift from Yuichiro Miyaoka (Addgene plasmid # 190604 ; http://n2t.net/addgene:190604 ; RRID:Addgene_190604) -
For your References section:
Genome editing is induced in a binary manner in single human cells. Takahashi G, Kondo D, Maeda M, Morishita Y, Miyaoka Y. iScience. 2022 Nov 17;25(12):105619. doi: 10.1016/j.isci.2022.105619. eCollection 2022 Dec 22. 10.1016/j.isci.2022.105619 PubMed 36483018
Map uploaded by the depositor.
