pUb-Cas9-mCherry_cU6:6-sgRNA
(Plasmid
#190598)
-
PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190598 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneSelf-assembly from various sources
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10296
-
Vector typeCRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4101
- Promoter Aedes aegypti polyubiquitin
-
Tag
/ Fusion Protein
- mCherry - separated by T2A (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaaacgcagacaaagcaaa (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA
-
Insert Size (bp)21
- Promoter Culex quinquefasciatus U6:6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggatcttgaaaagcacgtcccg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmid was cloned from multiple sources: Ae. aegypti polyubiquitin promoter-driven Cas9 from Addgene plasmid #162163 Cx. quinquefasciatus RNA Pol III U6:6 promoter-driven sgRNA cloning site from Feng et al. 2021 kindly provided by Dr. Valentino Gantz (then adapted by our lab for BspQI cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUb-Cas9-mCherry_cU6:6-sgRNA was a gift from Claudia Rueckert (Addgene plasmid # 190598 ; http://n2t.net/addgene:190598 ; RRID:Addgene_190598) -
For your References section:
Optimized In Vitro CRISPR/Cas9 Gene Editing Tool in the West Nile Virus Mosquito Vector, Culex quinquefasciatus. Torres TZB, Prince BC, Robison A, Ruckert C. Insects. 2022 Sep 19;13(9):856. doi: 10.3390/insects13090856. 10.3390/insects13090856 PubMed 36135557