Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRps9-WT-IRES-GFP-HygR
(Plasmid #190271)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190271 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEBO2
  • Total vector size (bp) 8967
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ribosomal protein RPS9
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2000
  • GenBank ID
    NM_029767.2
  • Promoter CAGGS-CMV
  • Tag / Fusion Protein
    • IRES-eGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site BstBI (unknown if destroyed)
  • 5′ sequencing primer ATCATTTTGGCAAAGAATTCACC
  • 3′ sequencing primer ATTTTCATTACATCTGTGTGTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRps9-WT-IRES-GFP-HygR was a gift from Erik Böttger (Addgene plasmid # 190271 ; http://n2t.net/addgene:190271 ; RRID:Addgene_190271)
  • For your References section:

    Error-prone protein synthesis recapitulates early symptoms of Alzheimer disease in aging mice. Brilkova M, Nigri M, Kumar HS, Moore J, Mantovani M, Keller C, Grimm A, Eckert A, Shcherbakov D, Akbergenov R, Seebeck P, Kramer SD, Wolfer DP, Gent TC, Bottger EC. Cell Rep. 2022 Sep 27;40(13):111433. doi: 10.1016/j.celrep.2022.111433. 10.1016/j.celrep.2022.111433 PubMed 36170830