Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPROEX-TwStrp-FTO
(Plasmid #190265)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 190265 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPROEX
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 4650
  • Total vector size (bp) 6288
  • Vector type
    Bacterial Expression
  • Selectable markers
    n/a

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For plasmid induction of FTO - transform in BL21(DE3), add 2mM IPTG and grow overnight at 16ºC.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FTO
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001080432.3
  • Entrez Gene
    FTO (a.k.a. ALKBH9, BMIQ14, GDFD, IFEX9)
  • Promoter Trc
  • Tags / Fusion Proteins
    • 6xHis (N terminal on insert)
    • Twin-Streptag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer GCGCTACGGCGTTTCACTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPROEX-TwStrp-FTO was a gift from Samie Jaffrey (Addgene plasmid # 190265 ; http://n2t.net/addgene:190265 ; RRID:Addgene_190265)