Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTW072
(Plasmid #190247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190247 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRANS230d
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA, Cas9, firefly luciferase, bar
  • gRNA/shRNA sequence
    gRNA1- gttttctcgcacttaagctc and gRNA2- cgacattcataacagagaca
  • Species
    other

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IS4 family transposase (genbank ID:WP_006250222.1) does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTW072 was a gift from Feng Zhang (Addgene plasmid # 190247 ; http://n2t.net/addgene:190247 ; RRID:Addgene_190247)
  • For your References section:

    Epigenetic features drastically impact CRISPR-Cas9 efficacy in plants. Weiss T, Crisp PA, Rai KM, Song M, Springer NM, Zhang F. Plant Physiol. 2022 Jun 11. pii: 6605859. doi: 10.1093/plphys/kiac285. 10.1093/plphys/kiac285 PubMed 35689624