pAAV-CamKII-DIO-hM4D(Gi)-mCherry
(Plasmid
#190240)
-
PurposeExpresses iDREADD fused to mCherry flanked by DIO
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5645
- Total vector size (bp) 7820
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehM4D(Gi)-mCherry
-
Alt nameiDREADD-mCherry
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2175
- Promoter mouse CamKII alpha
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc I (not destroyed)
- 3′ cloning site Nhe I (not destroyed)
- 5′ sequencing primer tcgtgtcgtgcctgagagcg
- 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CamKII-DIO-hM4D(Gi)-mCherry was a gift from Young J Yoon (Addgene plasmid # 190240 ; http://n2t.net/addgene:190240 ; RRID:Addgene_190240) -
For your References section:
Seizure-induced strengthening of a recurrent excitatory circuit in the dentate gyrus is proconvulsant. Nasrallah K, Frechou MA, Yoon YJ, Persaud S, Goncalves JT, Castillo PE. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2201151119. doi: 10.1073/pnas.2201151119. Epub 2022 Aug 5. 10.1073/pnas.2201151119 PubMed 35930664