pET-Duet1-6xHis-TEV-LC3BGlydelta5C
(Plasmid
#190237)
-
PurposePlasmid for the expression and purification of 6xHis-TEV-LC3BGlydelta5C. Internal reference: SMC893.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET Duet1
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 5780
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAP1LC3B
-
Alt nameLC3B
-
Alt nameATG8F
-
SpeciesH. sapiens (human)
-
Insert Size (bp)360
-
GenBank IDNC_000016.10
-
Entrez GeneMAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Duet1-6xHis-TEV-LC3BGlydelta5C was a gift from Sascha Martens (Addgene plasmid # 190237 ; http://n2t.net/addgene:190237 ; RRID:Addgene_190237) -
For your References section:
A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499