Skip to main content
Addgene

pSBbi-NLSmCherryNLS Clover-HDHB
(Plasmid #190223)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190223 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSBbi-RP
  • Backbone size w/o insert (bp) 6625
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Human DNA Helicase B (amino acids 994-1087)
  • Alt name
    HELB
  • Species
    H. sapiens (human)
  • Mutation
    Amino Acids 994-1087
  • Entrez Gene
    HELB (a.k.a. DHB, hDHB)
  • Promoter EF1a
  • Tag / Fusion Protein
    • Clover fluorescent protein (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site x (unknown if destroyed)
  • 3′ cloning site x (unknown if destroyed)
  • 5′ sequencing primer tcaagcctcagacagtggttc
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    NLS-mCherry-NLS-P2A-Puromycin
  • Insert Size (bp)
    1450
  • Promoter RPBSA

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site x (unknown if destroyed)
  • 3′ cloning site x (unknown if destroyed)
  • 5′ sequencing primer x
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.07.24.219907v2.full for BioRxiv preprint.
Addgene NGS results found N208D and E101G mutations in mCherry that do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-NLSmCherryNLS Clover-HDHB was a gift from Laura Heiser (Addgene plasmid # 190223 ; http://n2t.net/addgene:190223 ; RRID:Addgene_190223)

  • For your References section:

    Analysis and modeling of cancer drug responses using cell cycle phase-specific rate effects. Gross SM, Mohammadi F, Sanchez-Aguila C, Zhan PJ, Liby TA, Dane MA, Meyer AS, Heiser LM. Nat Commun. 2023 Jun 10;14(1):3450. doi: 10.1038/s41467-023-39122-z. 10.1038/s41467-023-39122-z PubMed 37301933
Related items: