Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pZac2.1 gfaABC1D-3xHA-SAPAP3
(Plasmid #190200)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190200 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PZac2.1
  • Backbone size w/o insert (bp) 5086
  • Total vector size (bp) 8104
  • Vector type
    Bacterial Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xHA-SAPAP3
  • Alt name
    HA-SAPAP3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3018
  • Entrez Gene
    Dlgap3 (a.k.a. BC058433, DAP-3, DAP3, Prpl8, Sapap3)
  • Promoter gfaABC1D
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ccactcccagttcaattacagc
  • 3′ sequencing primer catgccgggactggtggtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 gfaABC1D-3xHA-SAPAP3 was a gift from Baljit Khakh (Addgene plasmid # 190200 ; http://n2t.net/addgene:190200 ; RRID:Addgene_190200)
  • For your References section:

    Astrocyte-neuron subproteomes and obsessive-compulsive disorder mechanisms. Soto JS, Jami-Alahmadi Y, Chacon J, Moye SL, Diaz-Castro B, Wohlschlegel JA, Khakh BS. Nature. 2023 Apr;616(7958):764-773. doi: 10.1038/s41586-023-05927-7. Epub 2023 Apr 12. 10.1038/s41586-023-05927-7 PubMed 37046092