pZac2.1 gfaABC1D-LifeAct-GFP
(Plasmid #190199)

• Purpose: Expresses the small actin binding peptide, LifeAct, with a GFP reporter
• Depositing Lab: Baljit Khakh
• Publication: Soto et al Nature. 2023 Apr;616(7958):764-773. doi: 10.1038/s41586-023-05927-7. Epub 2023 Apr 12.

Backbone

• Vector backbone: PZac2.1
• Backbone size w/o insert (bp): 5103
• Total vector size (bp): 5973
• Vector type: Mammalian Expression, Bacterial Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LifeAct-eGFP
• Alt name: LifeAct-GFP
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 870
• Promoter: gfaABC1D
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ccactcccagttcaattacagc
• 3′ sequencing primer: gtcttgtagttgccgtcgtc

Resource Information

• Supplemental Documents:
  • PZac2.1 gfaABC1D_LifeAct-EGFP WPRE SV40.gb
• A portion of this plasmid was derived from a plasmid made by: Addgene plasmid 58470

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry