pGES401
(Plasmid #190198)

• Purpose: For CRISPR-Cas9 mediated multiple gene editing in soybean, single transcript unit system driven by soybean elongation factor 1A promoter (pM4), Basta selection
• Depositing Lab: Yuefeng Guan
• Publication: Bai et al Mol Plant. 2022 Jul 4;15(7):1081-1083. doi: 10.1016/j.molp.2022.05.011. Epub 2022 May 27.

Backbone

• Vector backbone: pCAMBIA1300
• Backbone manufacturer: CAMBIA
• Vector type: Plant Expression, CRISPR
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: spCas9
• Species: S. pyogenes
• Mutation: plant-codon optimized
• Promoter: Glycine max elongation factor 1A(pM4)
• Tag / Fusion Protein:
  • 3xFlag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GACAAGAAGTACAGCATCGG
• 3′ sequencing primer: aaccttcctcttcttcttagg

Resource Information

• Supplemental Documents:
  • Standard Construction Protocol of the Soybean Gene Editing Vector--pGES401

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry