Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGES401
(Plasmid #190198)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190198 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone manufacturer
    CAMBIA
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    spCas9
  • Species
    S. pyogenes
  • Mutation
    plant-codon optimized
  • Promoter Glycine max elongation factor 1A(pM4)
  • Tag / Fusion Protein
    • 3xFlag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GACAAGAAGTACAGCATCGG
  • 3′ sequencing primer aaccttcctcttcttcttagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGES401 was a gift from Yuefeng Guan (Addgene plasmid # 190198 ; http://n2t.net/addgene:190198 ; RRID:Addgene_190198)
  • For your References section:

    Combination of two multiplex genome-edited soybean varieties enables customization of protein functional properties. Bai M, Yuan C, Kuang H, Sun Q, Hu X, Cui L, Lin W, Peng C, Yue P, Song S, Guo Z, Guan Y. Mol Plant. 2022 Jul 4;15(7):1081-1083. doi: 10.1016/j.molp.2022.05.011. Epub 2022 May 27. 10.1016/j.molp.2022.05.011 PubMed 35643862