pGES201
(Plasmid #190197)

• Purpose: For CRISPR-Cas9 mediated gene editing in soybean, soybean elongation factor 1A promoter (pM4)-Cas9, GmU6-sgRNA, Basta selection
• Depositing Lab: Yuefeng Guan
• Publication: Bai et al Plant Biotechnol J. 2020 Mar;18(3):721-731. doi: 10.1111/pbi.13239. Epub 2019 Sep 9.

Backbone

• Vector backbone: pCAMBIA1300
• Backbone manufacturer: CAMBIA
• Vector type: Plant Expression, CRISPR
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: spCas9
• Species: S. pyogenes
• Mutation: plant-codon optimized
• Promoter: Glycine max elongation factor 1A(pM4)
• Tag / Fusion Protein:
  • 3xFlag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GACAAGAAGTACAGCATCGG
• 3′ sequencing primer: GTCGCCTCCCAGCTGAGACA

Resource Information

• Supplemental Documents:
  • Standard Construction Protocol of the Soybean Gene Editing Vector- -pGES201

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has an IS4 family transposase that exists in the original vector and does not affect function.