pCASB
(Plasmid #190175)

• Purpose: Plasmid for yeast expression of Cas9; contains a golden gate cloning site to additionally express a gRNA for a target sequence
• Depositing Lab: Jessica Tyler
• Publication: Aguilar et al Methods Protoc. 2022 Oct 4;5(5):79. doi: 10.3390/mps5050079.

Backbone

• Vector backbone: pCAS
• Backbone manufacturer: Addgene #60847
• Total vector size (bp): 8743
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: KanMX (select with G418 in yeast)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA cloning site
• Species: Synthetic
• Insert Size (bp): 22
• Mutation: Added 5'-agagacc-3' upstream and 5'-ggtctca-3' downstream of the gRNA site to allow for golden gate cloning of new gRNAs with the restriction enzyme Bsa1

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: gRNA_seq CGGAATAGGAACTTCAAAGCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is a modified version of pCAS (Addgene #60847) that has been improved to facilitate rapid cloning of new gRNA sequencing for streamlined CRISPR-Cas9 genome editing in yeast. pCAS was originally published by:
Ryan et al Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703.