Skip to main content
Addgene

pcDNA3.1_rSERT_C109A_Y107C
(Plasmid #190174)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190174 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA 3.1(+)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 7423
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC6A4 Serotonin Transporter
  • Alt name
    SERT
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1959
  • Mutation
    changed Cys109 to alanine, changed tyr107 to cysteine
  • GenBank ID
    NC_051345 NM_013034.4
  • Entrez Gene
    Slc6a4 (a.k.a. SERT)
  • Promoter CMV
  • Tags / Fusion Proteins
    • c-myc (N terminal on insert)
    • His6 (C terminal on insert)
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGCCAACATGCCAGCATCC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    B J Hoffman, Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_rSERT_C109A_Y107C was a gift from Gary Rudnick (Addgene plasmid # 190174 ; http://n2t.net/addgene:190174 ; RRID:Addgene_190174)

  • For your References section:

    Ibogaine, a noncompetitive inhibitor of serotonin transport, acts by stabilizing the cytoplasm-facing state of the transporter. Jacobs MT, Zhang YW, Campbell SD, Rudnick G. J Biol Chem. 2007 Oct 5;282(40):29441-7. doi: 10.1074/jbc.M704456200. Epub 2007 Aug 13. 10.1074/jbc.M704456200 PubMed 17698848
Related items: