iLID-mCl3-MAP7N
(Plasmid #190167)

• Purpose: Expresses iLID-mCl3-MAP7N, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60, in mammalian cells.
• Depositing Lab: Anna Akhmanova
• Publication: Meiring et al Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28.

Backbone

• Vector backbone: pB80
• Backbone manufacturer: Lukas Kapitein lab
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 8487
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iLID-mClover3-MAP7N
• Alt name: iLID-mCl3-MAP7N(1-309)
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2262
• Mutation: aa 1-309 from human MAP7 delta175-213
• GenBank ID: NM_001388339.1
• Tag / Fusion Protein:
  • iLID-mClover3 (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcttctggcgtgtgaccggcgg
• 3′ sequencing primer: cctcccacacctccccctgaacct

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry