AAV_pMBP-EGFP-caax
(Plasmid #190155)

• Purpose: Expresses membrane-targeted EGFP in oligodendrocytes; AAV vector
• Depositing Lab: Brad Zuchero
• Publication: Lam et al Nat Commun. 2022 Sep 23;13(1):5583. doi: 10.1038/s41467-022-33200-4.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pBZ-167 AAV CMV promoter base vector
• Backbone manufacturer: Zuchero lab
• Backbone size w/o insert (bp): 4561
• Total vector size (bp): 5640
• Modifications to backbone: Removed CMV promoter, replaced with MBP promoter for oligodendrocyte expression (Gow...Lazzarini 1991, PMID:1383235)
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Due to repetitive elements (AAV ITRs) we propagate using recombination-deficient bacteria, eg Stabl3 or NEB Stable. Alternatively it may be possible to use a standard bacterial strain and grow at 30C for longer, which may reduce recombination. Always fully sequence after propagation.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP-caax
• Alt name: EGFP-farnesyl tag
• Species: Synthetic
• Insert Size (bp): 792
• Promoter: MBP

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCCTCTTTTCCCGAGATG
• 3′ sequencing primer: TATTAGGACAAGGCTGGTGGGCAC

Resource Information

• Supplemental Documents:
  • 190155_pBZ-281 AAV_pMBP-(NcoI)-GFP-Caax_hGHpolyA.gbk
• A portion of this plasmid was derived from a plasmid made by: EGFP-caax was derived from a plasmid constructed by Trent Watkins and Ben Barres
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PMID: 19038214.

Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.