pCMV-Vamp3-pHluorin
(Plasmid #190152)

• Purpose: Expresses (pH-sensitive) super ecliptic pHluorin-tagged rat Vamp3 for imaging exocytosis
• Depositing Lab: Brad Zuchero
• Publication: Lam et al Nat Commun. 2022 Sep 23;13(1):5583. doi: 10.1038/s41467-022-33200-4.

Backbone

• Vector backbone: pBZ-167 AAV CMV promoter base vector
• Backbone manufacturer: Zuchero lab
• Backbone size w/o insert (bp): 4561
• Total vector size (bp): 5640
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Due to repetitive elements (AAV ITRs) we propagate using recombination-deficient bacteria, eg Stabl3 or NEB Stable. Alternatively it may be possible to use a standard bacterial strain and grow at 30C for longer, which may reduce recombination. Always fully sequence after propagation.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Vamp3
• Species: R. norvegicus (rat)
• Insert Size (bp): 309
• Entrez Gene: Vamp3 (a.k.a. D130027G05Rik, VAMP-3, ceb)
• Promoter: CMV
• Tag / Fusion Protein:
  • superecliptic pHluorin (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cgcctggagacgccatcc
• 3′ sequencing primer: tattaggacaaggctggtgggcac

Resource Information

• Supplemental Documents:
  • 190152_pBZ-261 AAV_pCMV-Vamp3-pHluorin.gbk
• A portion of this plasmid was derived from a plasmid made by: Prof. Stephanie Gupton (UNC Chapel Hill)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vamp3-pHluorin was cloned from a construct kindly provided by Prof. Stephanie Gupton, from this paper: PMID: 29351997.

Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.