Skip to main content
Addgene

pCMV-Vamp2-pHluorin
(Plasmid #190151)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190151 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBZ-167 AAV CMV promoter base vector
  • Backbone manufacturer
    Zuchero lab
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Due to repetitive elements (AAV ITRs) we propagate using recombination-deficient bacteria, eg Stabl3 or NEB Stable. Alternatively it may be possible to use a standard bacterial strain and grow at 30C for longer, which may reduce recombination. Always fully sequence after propagation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vamp2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    384
  • Entrez Gene
    Vamp2 (a.k.a. Syb-2, Syb2, Vamp-2, sybII)
  • Promoter CMV
  • Tag / Fusion Protein
    • superecliptic pHluorin (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCCTGGAGACGCCATCC
  • 3′ sequencing primer tattaggacaaggctggtgggcac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vamp2-pHluorin was cloned from a construct kindly provided by Prof. Stephanie Gupton, from this paper: PMID: 29351997.

Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Vamp2-pHluorin was a gift from Brad Zuchero (Addgene plasmid # 190151 ; http://n2t.net/addgene:190151 ; RRID:Addgene_190151)
  • For your References section:

    CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes. Lam M, Takeo K, Almeida RG, Cooper MH, Wu K, Iyer M, Kantarci H, Zuchero JB. Nat Commun. 2022 Sep 23;13(1):5583. doi: 10.1038/s41467-022-33200-4. 10.1038/s41467-022-33200-4 PubMed 36151203