Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HiFi iFE
(Plasmid #190141)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190141 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330A
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HiFi Cas9-POLB
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    5340
  • Mutation
    SpCas9 R691A mutant, Codon Optimized for mammalian cells
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • 3′ sequencing primer T3 (GCAATTAACCCTCACTAAAGG)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Takashi Yamamoto

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Supplemental GenBank file: pX330A-1x6 (Plasmid #58770) . Please visit https://doi.org/10.1101/2022.12.05.518807 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HiFi iFE was a gift from Timothy Lu (Addgene plasmid # 190141 ; http://n2t.net/addgene:190141 ; RRID:Addgene_190141)
  • For your References section:

    Frame Editors for Precise, Template-Free Frameshifting. Nakade S, Nakamae K, Tang T-C, Yu D, Sakuma T, Yamamoto T, Lu TK. bioRxiv 2022.12.05.518807 10.1101/2022.12.05.518807
Commonly requested with: