AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
(Plasmid #190112)

• Purpose: AAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFP
• Depositing Lab: Keith Joung
• Publication: Grunewald et al Nat Biotechnol. 2023 Mar;41(3):337-343. doi: 10.1038/s41587-022-01473-1. Epub 2022 Sep 26.

Backbone

• Vector backbone: AAV
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: MMLV-RT(dRH)
• Species: Synthetic
• Mutation: mutations from RT in PE2 and truncation of RNAse H domain (C-terminal 181AA)
• Promoter: EFS
• Tags / Fusion Proteins:
  • bpNLS (N terminal on insert)
  • bpNLS-P2A-eGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: n/a

Gene/Insert 2

• Gene/Insert name: U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
• Alt name: pegRNA: ggcccagactgagcacgtga, ngRNA: gtcaaccagtatcccggtgc
• Promoter: U6, H1

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: n/a

Resource Information

• Supplemental Documents:
  • AAV2_for_Split-PE,_gRNAs_+_MMLV-RT(dRH)-P2A-eGFP_(PKC1002).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry