Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
(Plasmid #190112)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190112 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MMLV-RT(dRH)
  • Species
    Synthetic
  • Mutation
    mutations from RT in PE2 and truncation of RNAse H domain (C-terminal 181AA)
  • Promoter EFS
  • Tags / Fusion Proteins
    • bpNLS (N terminal on insert)
    • bpNLS-P2A-eGFP (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
  • Alt name
    pegRNA: ggcccagactgagcacgtga, ngRNA: gtcaaccagtatcccggtgc
  • Promoter U6, H1

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002) was a gift from Keith Joung (Addgene plasmid # 190112 ; http://n2t.net/addgene:190112 ; RRID:Addgene_190112)
  • For your References section:

    Engineered CRISPR prime editors with compact, untethered reverse transcriptases. Grunewald J, Miller BR, Szalay RN, Cabeceiras PK, Woodilla CJ, Holtz EJB, Petri K, Joung JK. Nat Biotechnol. 2023 Mar;41(3):337-343. doi: 10.1038/s41587-022-01473-1. Epub 2022 Sep 26. 10.1038/s41587-022-01473-1 PubMed 36163548