Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRT498-OtUBD(V203D)
(Plasmid #190090)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190090 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRT498
  • Backbone manufacturer
    Hochstrasser Lab
  • Backbone size w/o insert (bp) 6312
  • Total vector size (bp) 7199
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    OtUBD(V203D)
  • Alt name
    OtDUB(170-264, V203D)
  • Species
    Orientia Tsutsugamushi
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • MBP (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTGTCGATGAAGCCCTGAAAG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRT498-OtUBD(V203D) was a gift from Mark Hochstrasser (Addgene plasmid # 190090 ; http://n2t.net/addgene:190090 ; RRID:Addgene_190090)
  • For your References section:

    A versatile new tool derived from a bacterial deubiquitylase to detect and purify ubiquitylated substrates and their interacting proteins. Zhang M, Berk JM, Mehrtash AB, Kanyo J, Hochstrasser M. PLoS Biol. 2022 Jun 30;20(6):e3001501. doi: 10.1371/journal.pbio.3001501. eCollection 2022 Jun. 10.1371/journal.pbio.3001501 PubMed 35771886