pRT498-OtUBD(V203D)
(Plasmid #190090)

• Purpose: Expresses OtUBD(V203D) mutant that is unable to bind ubiquitin with an TEV-cleavable N-terminal 6xHis-MBP tag as well as an engineered N-terminal cysteine in E. coli
• Depositing Lab: Mark Hochstrasser
• Publication: Zhang et al PLoS Biol. 2022 Jun 30;20(6):e3001501. doi: 10.1371/journal.pbio.3001501. eCollection 2022 Jun.

Backbone

• Vector backbone: pRT498
• Backbone manufacturer: Hochstrasser Lab
• Backbone size w/o insert (bp): 6312
• Total vector size (bp): 7199
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: OtUBD(V203D)
• Alt name: OtDUB(170-264, V203D)
• Species: Orientia Tsutsugamushi
• Tags / Fusion Proteins:
  • 6xHis (N terminal on backbone)
  • MBP (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GACTGTCGATGAAGCCCTGAAAG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pRT498_MBP_OtUBD(V203D).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry