35S::Cel1SP-GeNL/pCAMBIA1301
(Plasmid
#190069)
-
PurposeExpressing bioluminescent pH indicator-GeNL- in Arabidopsis thaliana apoplast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCambia1301
-
Backbone manufacturerCambia, Australia
- Backbone size w/o insert (bp) 11849
- Total vector size (bp) 14874
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCel1 signal peptide-Green-enhanced Nano-lantern
-
Alt nameCel1SP-GeNL
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1260
- Promoter CaMV 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoT22I (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer agcATGCATatggcgcgaaaatccctaattt
- 3′ sequencing primer CATGGAGCTCTTACGCCAGAATGCGTTCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGeNL was amplified from GeNL/pcDNA3 (Suzuki et al., 2016), Addgene #85200.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
35S::Cel1SP-GeNL/pCAMBIA1301 was a gift from Takeharu Nagai (Addgene plasmid # 190069 ; http://n2t.net/addgene:190069 ; RRID:Addgene_190069) -
For your References section:
Application of Green enhanced Nano-lantern as a bioluminescent ratiometric indicator for measurement of Arabidopsis thaliana root apoplastic fluid pH. Tran Q, Osabe K, Entani T, Wazawa T, Hattori M, Nagai T. Plant Cell Environ. 2022 Jul 21. doi: 10.1111/pce.14404. 10.1111/pce.14404 PubMed 35864560