pGTM_YR375_SUMO_Protease_001
(Plasmid #190063)

• Purpose: Expresses the yeast Ulp1 Sumo protease in active form as a TEV protease-cleavable MBP fusion
• Depositing Lab: Gaetano Montelione
• Publication: Mazzei et al STAR Protoc. 2023 May 5;4(2):102326. doi: 10.1016/j.xpro.2023.102326.

Backbone

• Vector backbone: pET15_8HMbpTEV_NESG
• Backbone manufacturer: Novagen/Northeast Structural Genomics Consortium
• Backbone size w/o insert (bp): 6868
• Total vector size (bp): 7912
• Modifications to backbone: This vector contains an N-terminal 8X-His tag fused in frame with the Maltose Binding Protein (MBP) Solubility Enhancing Tag (SET). The passenger protein (Ulp1 residues 347 - 621) can be cleaved from the MBP tag by Tobacco Etch Virus Protease (TEV).
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ULP1_YEAST
• Alt name: Sumo Protease
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1044
• Mutation: Construct contains residues 347 – 621
• GenBank ID: NP_015305 NP_015305
• Entrez Gene: ULP1 (a.k.a. YPL020C, NIB1)
• Promoter: T7 lac
• Tag / Fusion Protein:
  • 8X His-MBP (Maltose Binding Protein) (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: attaacggcgacggtgccgggc
• 3′ sequencing primer: T7 Reverse

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA