-
PurposeRed Fluorescent Protein for Long-Term Labeling of Fine Structures in Neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 6103
- Total vector size (bp) 6892
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCrimson
-
Insert Size (bp)789
- Promoter caggs
-
Tag
/ Fusion Protein
- CAAX (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATCTGCATGAGCTAGCCGCCACCATGGTGAGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC3.1-caggs-Crimson-CAAX was a gift from Michael Lin (Addgene plasmid # 190041 ; http://n2t.net/addgene:190041 ; RRID:Addgene_190041) -
For your References section:
A Bright, Nontoxic, and Non-aggregating red Fluorescent Protein for Long-Term Labeling of Fine Structures in Neurons. Ning L, Geng Y, Lovett-Barron M, Niu X, Deng M, Wang L, Ataie N, Sens A, Ng HL, Chen S, Deisseroth K, Lin MZ, Chu J. Front Cell Dev Biol. 2022 Jun 29;10:893468. doi: 10.3389/fcell.2022.893468. eCollection 2022. 10.3389/fcell.2022.893468 PubMed 35846353