pCAG-WIPI2d (FRRG/AAAA)-TS
(Plasmid
#190037)
-
PurposeExpression of wipi2d mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWIPI2d
-
Alt namewipi2d (FRRG to AAA)-TEVsite-two strep tag
-
SpeciesH. sapiens (human)
-
Mutation223FRRG to AAAA
-
GenBank IDAM392901.1
-
Entrez GeneWIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
- Promoter CMV
-
Tag
/ Fusion Protein
- TEV-2xStrep tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site XmaI (unknown if destroyed)
- 5′ sequencing primer 5'- CTTCTTCTTTTTCCTACAGCTCCTGGGC
- 3′ sequencing primer 5'- gagccagggcattggccacac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-WIPI2d (FRRG/AAAA)-TS was a gift from James Hurley (Addgene plasmid # 190037 ; http://n2t.net/addgene:190037 ; RRID:Addgene_190037) -
For your References section:
A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499