Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR_PGK_LaG17-mCherry-HOTag3
(Plasmid #190024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190024 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR PGK
  • Backbone size w/o insert (bp) 8912
  • Total vector size (bp) 10214
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LaG17 CluMPS
  • Alt name
    LaG17-mCh-HOTag3
  • Species
    Synthetic
  • Insert Size (bp)
    1302
  • Promoter PGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcttcaaaagcgcacgtct
  • 3′ sequencing primer caatctttcacaaattttgtaatccagagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR_PGK_LaG17-mCherry-HOTag3 was a gift from Lukasz Bugaj (Addgene plasmid # 190024 ; http://n2t.net/addgene:190024 ; RRID:Addgene_190024)
  • For your References section:

    Simple visualization of submicroscopic protein clusters with a phase-separation-based fluorescent reporter. Mumford TR, Rae D, Brackhahn E, Idris A, Gonzalez-Martinez D, Pal AA, Chung MC, Guan J, Rhoades E, Bugaj LJ. Cell Syst. 2024 Feb 21;15(2):166-179.e7. doi: 10.1016/j.cels.2024.01.005. Epub 2024 Feb 8. 10.1016/j.cels.2024.01.005 PubMed 38335954