Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCriprV2-sgRNA-PER1-#2
(Plasmid #189988)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 189988 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Zhang lab, addgene #52961
  • Backbone size w/o insert (bp) 14873
  • Total vector size (bp) 13013
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Only amplify in RecA- bacteria
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Period1
  • gRNA/shRNA sequence
    TAGGAGAAGAAAGCCTCTCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PER1 (a.k.a. PER, RIGUI, hPER)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BmBI (destroyed during cloning)
  • 3′ cloning site BmBI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer --
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCriprV2-sgRNA-PER1-#2 was a gift from Achim Kramer (Addgene plasmid # 189988 ; http://n2t.net/addgene:189988 ; RRID:Addgene_189988)
  • For your References section:

    Circadian period is compensated for repressor protein turnover rates in single cells. Gabriel CH, del Olmo MH, Widini AR, Roshanbin R, Woyde J, Hamza E, Gutu N, Zehtabian A, Ewers H, Granada AE, Herzel H, Kramer A. bioRxiv 2024.02.06.579141 10.1101/2024.02.06.579141