pCRISPRai
(Plasmid
#189938)
-
PurposeExpresses CRISPRai cassette under EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189938 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneT&A cloning vector
-
Backbone manufacturerRBC
- Backbone size w/o insert (bp) 2729
- Total vector size (bp) 11410
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPRai cassette
-
SpeciesSynthetic; streptococcus pyogenes
-
Insert Size (bp)9171
- Promoter CMV enhancer-rat EF1 alpha
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAGTAGTGCGCGAGC
- 3′ sequencing primer ACAAGCTTGTCGAGACTGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRai was a gift from Yu-Chen Hu (Addgene plasmid # 189938 ; http://n2t.net/addgene:189938 ; RRID:Addgene_189938) -
For your References section:
CRISPRai for simultaneous gene activation and inhibition to promote stem cell chondrogenesis and calvarial bone regeneration. Truong VA, Hsu MN, Kieu Nguyen NT, Lin MW, Shen CC, Lin CY, Hu YC. Nucleic Acids Res. 2019 Jul 26;47(13):e74. doi: 10.1093/nar/gkz267. 10.1093/nar/gkz267 PubMed 30997496