Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRISPRai
(Plasmid #189938)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189938 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    T&A cloning vector
  • Backbone manufacturer
    RBC
  • Backbone size w/o insert (bp) 2729
  • Total vector size (bp) 11410
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPRai cassette
  • Species
    Synthetic; streptococcus pyogenes
  • Insert Size (bp)
    9171
  • Promoter CMV enhancer-rat EF1 alpha

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGAGTAGTGCGCGAGC
  • 3′ sequencing primer ACAAGCTTGTCGAGACTGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRai was a gift from Yu-Chen Hu (Addgene plasmid # 189938 ; http://n2t.net/addgene:189938 ; RRID:Addgene_189938)
  • For your References section:

    CRISPRai for simultaneous gene activation and inhibition to promote stem cell chondrogenesis and calvarial bone regeneration. Truong VA, Hsu MN, Kieu Nguyen NT, Lin MW, Shen CC, Lin CY, Hu YC. Nucleic Acids Res. 2019 Jul 26;47(13):e74. doi: 10.1093/nar/gkz267. 10.1093/nar/gkz267 PubMed 30997496