p1X-UASTattB
(Plasmid
#189861)
-
Purpose(Empty Backbone) Fly cloning and transformation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUASTattB
- Backbone size (bp) 8489
-
Modifications to backbone5 copies of UAS sequence replaced with 1 copy of UAS
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer atttcactggaactaggctagc
- 3′ sequencing primer catcatgatggaccagatgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p1X-UASTattB was a gift from Jung Hwan Kim (Addgene plasmid # 189861 ; http://n2t.net/addgene:189861 ; RRID:Addgene_189861) -
For your References section:
Generation and validation of pX-UASTattB for dose-dependent misexpression studies in Drosophila. Singh M, Kim JH. MicroPubl Biol. 2022 Aug 12;2022. doi: 10.17912/micropub.biology.000626. eCollection 2022. 10.17912/micropub.biology.000626 PubMed 36039330