Skip to main content
Addgene

p3X-UASTattB
(Plasmid #189859)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189859 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUASTattB
  • Backbone size (bp) 8489
  • Modifications to backbone
    5 copies of UAS sequence replaced with 3 copies of UAS
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer atttcactggaactaggctagc
  • 3′ sequencing primer catcatgatggaccagatgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3X-UASTattB was a gift from Jung Hwan Kim (Addgene plasmid # 189859 ; http://n2t.net/addgene:189859 ; RRID:Addgene_189859)
  • For your References section:

    Generation and validation of pX-UASTattB for dose-dependent misexpression studies in Drosophila. Singh M, Kim JH. MicroPubl Biol. 2022 Aug 12;2022. doi: 10.17912/micropub.biology.000626. eCollection 2022. 10.17912/micropub.biology.000626 PubMed 36039330