Syn61Δ3(ev5) ΔrecA (ev1)
(Bacterial strain #189857)

• Purpose: Laboratory adapted, genomically recoded E. coli strain without TCG, TCA, or TAG codons and deleted serT, serU, prfA, and recA genes. Evolved for ~270 generations in LB at 37 °C.
• Depositing Lab: George Church
• Publication: Nyerges et al Nature. 2023 Mar;615(7953):720-727. doi: 10.1038/s41586-023-05824-z. Epub 2023 Mar 15.

Backbone

• Vector backbone: N.A.

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Syn61Δ3(ev5) ΔrecA (ev1)
• Growth instructions: Grow in LB, SOB, or 2×YT at 37°C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ΔrecA
• Species: Synthetic
• Mutation: ΔrecA

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GAGTTTACGTCGCAGTTCTTG
• 3′ sequencing primer: ACTGAAAGCGGCTCGTGCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The strain is a ΔrecA, evolved derivative of Syn61Δ3(ev5) (Addgene #174514).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Details of construction, use, and characterization are available in
Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367
https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full