Skip to main content
Addgene

Syn61Δ3(ev5) ΔrecA (ev1)
(Bacterial strain #189857)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 189857 Bacteria in agar stab 1 $85

Backbone

  • Vector backbone
    N.A.

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Syn61Δ3(ev5) ΔrecA (ev1)
  • Growth instructions
    Grow in LB, SOB, or 2×YT at 37°C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ΔrecA
  • Species
    Synthetic
  • Mutation
    ΔrecA

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAGTTTACGTCGCAGTTCTTG
  • 3′ sequencing primer ACTGAAAGCGGCTCGTGCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The strain is a ΔrecA, evolved derivative of Syn61Δ3(ev5) (Addgene #174514).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Details of construction, use, and characterization are available in
Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM (2022) Swapped genetic code blocks viral infections and gene transfer, https://doi.org/10.1101/2022.07.08.499367
https://www.biorxiv.org/content/10.1101/2022.07.08.499367v1.full

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Syn61Δ3(ev5) ΔrecA (ev1) was a gift from George Church (Addgene plasmid # 189857)
  • For your References section:

    A swapped genetic code prevents viral infections and gene transfer. Nyerges A, Vinke S, Flynn R, Owen SV, Rand EA, Budnik B, Keen E, Narasimhan K, Marchand JA, Baas-Thomas M, Liu M, Chen K, Chiappino-Pepe A, Hu F, Baym M, Church GM. Nature. 2023 Mar;615(7953):720-727. doi: 10.1038/s41586-023-05824-z. Epub 2023 Mar 15. 10.1038/s41586-023-05824-z PubMed 36922599