p15A-OptoCre-cat-T172A-P-R
(Plasmid
#189854)
-
PurposeCre-inducible activation of cat-T172A for chloramphenicol resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBbA-k
- Backbone size w/o insert (bp) 2297
- Total vector size (bp) 3427
-
Vector typeBacterial Expression, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWhen transformed with Opto-Cre-Vvd2, store in the dark.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameP-loxP-TT-loxP-R-catT172A
-
Insert Size (bp)1130
- Promoter P (T7 phage gene 10)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCTTCCCCATCGGTGATGTCG
- 3′ sequencing primer TTTCGCCACCACTGATTTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p15A-OptoCre-cat-T172A-P-R was a gift from Mary Dunlop (Addgene plasmid # 189854 ; http://n2t.net/addgene:189854 ; RRID:Addgene_189854) -
For your References section:
An optogenetic toolkit for light-inducible antibiotic resistance. Sheets MB, Tague N, Dunlop MJ. Nat Commun. 2023 Feb 23;14(1):1034. doi: 10.1038/s41467-023-36670-2. 10.1038/s41467-023-36670-2 PubMed 36823420